Sequence ID | >WENV170013162 |
Genome ID | ATLU01000116 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 152 |
End posion on genome | 77 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gttgttagcg |
tRNA gene sequence |
GCCCATGTAGCTCAGTTGGTAGAGCACACCCTTGGTAAGGGTGAGGTCAGCAGTTCAAAT |
Downstream region at tRNA end position |
ttaatccagt |
Secondary structure (Cloverleaf model) | >WENV170013162 Thr GGT g TCCA ttaatccagt G - C C - G C - G C - G A - T T - A G - C T A T T C G T C A T G A A | | | | | A T C T C G A G C A G C G | | | | T T G G A G C T A A AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |