Sequence ID | >WENV170013187 |
Genome ID | ATLU01000222 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 4879 |
End posion on genome | 4955 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cccctcatgc |
tRNA gene sequence |
GCGGTTGTAGCTCAGTTGGTTAGAGTACCGGCCTGTCACGCCGGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
tttatccccc |
Secondary structure (Cloverleaf model) | >WENV170013187 Asp GTC c GCCA tttatccccc G - C C - G G - C G - C T - A T - A G - C T G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T T A A GGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |