Sequence ID | >WENV170013188 |
Genome ID | ATLU01000228 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 4252 |
End posion on genome | 4328 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gctcttttac |
tRNA gene sequence |
AGGCGCGTAGCTCAGTTGGTTAGAGCACTACCTTGACATGGTAGGGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
acaccttaaa |
Secondary structure (Cloverleaf model) | >WENV170013188 Val GAC c ACCA acaccttaaa A - T G - C G - C C - G G - C C - G G - C T A T T A G C C A T G A A + | + | | G T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |