Sequence ID | >WENV170013213 |
Genome ID | ATLU01000476 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 3756 |
End posion on genome | 3832 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
accagaatgt |
tRNA gene sequence |
TCCCTACGGCCCCTACTGGCAGGGGGGCACGGCTGTTAACCGTGTTGTTCAAGGTTCGAG |
Downstream region at tRNA end position |
aaacacttgc |
Secondary structure (Cloverleaf model) | >WENV170013213 Asn GTT t GCCA aaacacttgc T - A C - G C - G C - G T - A A - T C - G T G G G T T C C A C A T G | | | | | G T C C C C C A A G G C G | | | | T T G G G G G C A G G TTGTT C - G A - T C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |