Sequence ID | >WENV170013227 |
Genome ID | ATLU01000707 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 2268 |
End posion on genome | 2341 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cagccccaac |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGCAGCTTCCCAAGCTGAATACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
atctcccgcc |
Secondary structure (Cloverleaf model) | >WENV170013227 Gly CCC c TCCA atctcccgcc G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A ATAC G A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |