Sequence ID | >WENV170013256 |
Genome ID | ATLU01001368 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1395 |
End posion on genome | 1321 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ctaagccttt |
tRNA gene sequence |
GCGGGTATAGCTCAGTGGTAGAGCAGGAGGTTTCCAACCTTCGTGTCGTCGGTTCGATCC |
Downstream region at tRNA end position |
aaagatgctc |
Secondary structure (Cloverleaf model) | >WENV170013256 Gly TCC t TCCA aaagatgctc G - C C - G G - C G - C G - C T - A A - T C T T T A G C C A G A A + | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A A GTGTC G - C G + T A - T G - C G - C T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |