Sequence ID | >WENV170013262 |
Genome ID | ATLU01001447 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 1703 |
End posion on genome | 1779 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tcacaaacac |
tRNA gene sequence |
GGGGCGTTGGTCTAGCGGTCTAGGACGCTGCACTTTCAATGCGGAGATCACGGGTTCGAA |
Downstream region at tRNA end position |
aaaaccgctc |
Secondary structure (Cloverleaf model) | >WENV170013262 Glu TTC c ACCA aaaaccgctc G + T G - C G - C G - C C - G G - C T - A T A T T G C C C A C G A G | | | | | G G T C T G A C G G G C G + | | | T T T G G A C C T A G AGATC C - G T + G G - C C - G A - T C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |