Sequence ID | >WENV170013270 |
Genome ID | ATLU01001665 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 77 |
End posion on genome | 2 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tgtaagcaat |
tRNA gene sequence |
GGGTCATTAGCTCAGTCGGTAGAGCAGCTCCCTTTTAAGGAGAAGGTCCTGAGTTCGAGC |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170013270 Lys TTT t ACCA annnnnnnnn G - C G - C G - C T - A C - G A - T T - A C G T G G C T C A T G A A | + | | | G C C T C G C T G A G C G | | | | T T G G A G C T A A AGGTC G A C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |