Sequence ID | >WENV170013273 |
Genome ID | ATLU01001916 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 541 |
End posion on genome | 456 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cagaggcgtg |
tRNA gene sequence |
GCCCAAGTGGCGGAATGGTAGACGCAGGGGATTCAAAATCCCCCGCCTTCACGGGCGTGA |
Downstream region at tRNA end position |
catatccgcg |
Secondary structure (Cloverleaf model) | >WENV170013273 Leu CAA g ACCA catatccgcg G - C C - G C - G C - G A - T A - T G - C T G T C T C T C A T A A G | | | | | G G G G C G G A G A G C G | | | T T T A C G C A G A CGCCTTCACGGGCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |