Sequence ID | >WENV170013277 |
Genome ID | ATLU01002200 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 554 |
End posion on genome | 478 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ccgaccatag |
tRNA gene sequence |
GCACCTGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCAGAGGTTCGAA |
Downstream region at tRNA end position |
caaaacctct |
Secondary structure (Cloverleaf model) | >WENV170013277 Arg CCG g GCCA caaaacctct G - C C - G A - T C - G C - G T - A G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |