Sequence ID | >WENV170013310 |
Genome ID | ATLU01004277 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 520 |
End posion on genome | 605 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaattaactt |
tRNA gene sequence |
GCGCAGGTGGTGAAATGGTAGACACGCACGCTTGAGGGGCGTGTGAACTTCGGTTCGTGA |
Downstream region at tRNA end position |
aatacacata |
Secondary structure (Cloverleaf model) | >WENV170013310 Leu GAG t ACCA aatacacata G - C C - G G - C C - G A - T G - C G + T T G T C T C C C A T A A G | | | | | A G A G T G G A G G G C G | | | T T T A C A C A G G TGAACTTCGGTTCGT C - G A - T C - G G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |