| Sequence ID | >WENV170013457 |
| Genome ID | AUZX01007616 |
| Phylum/Class | [AUZX] mine drainage metagenome; uppermost (B1A) sediment-attached strata from acid streamer/mats thriving at Los Rueldos |
| Species | |
| Start position on genome | 292 |
| End posion on genome | 368 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
tcgcaaccgc |
| tRNA gene sequence |
GCGCCCCTAGCTCAGTTGGATAGAGCGTCTGGCTACGAACCAGAAGGTCGGGAGTTCGAA |
| Downstream region at tRNA end position |
caattccatt |
| Secondary structure (Cloverleaf model) | >WENV170013457 Arg ACG
c ACCA caattccatt
G - C
C - G
G - C
C - G
C - G
C - G
C - G T A
T C T C T C A
T G A A | + | | | G
T C T C G G G G A G C
G | | | | T T
G G A G C
A T A G AGGTC
T - A
C - G
T - A
G - C
G - C
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |