| Sequence ID | >WENV170013533 |
| Genome ID | AUZX01015741 |
| Phylum/Class | [AUZX] mine drainage metagenome; uppermost (B1A) sediment-attached strata from acid streamer/mats thriving at Los Rueldos |
| Species | |
| Start position on genome | 1292 |
| End posion on genome | 1363 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
aaaccctaaa |
| tRNA gene sequence |
GGGCTCGTAGTCTAGCGGTATGATGTCTCCCTGACACGGAGAAGGTCACCGGTTCAAATC |
| Downstream region at tRNA end position |
aaatattggg |
| Secondary structure (Cloverleaf model) | >WENV170013533 Val GAC
a Attc aaatattggg
G - C
G - C
G - C
C - G
T + G
C - G
G - C T A
T T G G C C A
G A A | | | | | A
C T C T G A C C G G C
G | | + T T
G T G A T
T A G AGGTC
T - A
C - G
T - A
C - G
C - G
C C
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |