Sequence ID | >WENV170014089 |
Genome ID | AVFP01006633 |
Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
Species | |
Start position on genome | 452 |
End posion on genome | 538 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agagaaaaat |
tRNA gene sequence |
GGAGAGGTGCCAGAGTGGTAATGGAGCAGATTGCTAATCTGTCAACGCGTAAGTGTTGCC |
Downstream region at tRNA end position |
tcgcccgctg |
Secondary structure (Cloverleaf model) | >WENV170014089 Ser GCT t GCCT tcgcccgctg G - C G - C A - T G - C A - T G - C G + T T A T G G C C C A G A G | | | | | G T G A C C C C G G G C G | | | T T G A T G G T A A CAACGCGTAAGTGTTGC G + T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |