Sequence ID | >WENV170014331 |
Genome ID | AYRE01000875 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 175 |
End posion on genome | 99 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gcataccagt |
tRNA gene sequence |
CGGAGTGTAGCGCAGCCTGGTAGCGCACCTGGTTTGGGACCAGGGGGTCGAAGGTTCGAG |
Downstream region at tRNA end position |
tttttaaatt |
Secondary structure (Cloverleaf model) | >WENV170014331 Pro TGG t ACCA tttttaaatt C - G G - C G - C A - T G - C T - A G - C T G T T T T C C A C G A A + | | | | G C C G C G G A A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |