Sequence ID | >WENV170014351 |
Genome ID | AYRE01005779 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 178 |
End posion on genome | 103 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaaattagtg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGCCCTGGATTGTGATTCCGGTGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
ttaattttgg |
Secondary structure (Cloverleaf model) | >WENV170014351 His GTG g CCCA ttaattttgg G - C T - A G - C G - C C - G T - A A - T T A T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A C TGGTC C - G T + G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |