Sequence ID | >WENV170014365 |
Genome ID | AYRF01000755 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 699 |
End posion on genome | 624 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
caaaatatat |
tRNA gene sequence |
GCACGAGTAGCTCAGTTGGAAGAGCAGCGCCCTTCTAAGGCGAAGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
tttaagtcca |
Secondary structure (Cloverleaf model) | >WENV170014365 Arg TCT t ACCA tttaagtcca G + T C - G A - T C - G G - C A - T G - C C G T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A A A AGGTC G A C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |