The detailed information of tRNA gene sequence


Sequence ID>WENV170014369
Genome IDAYRF01001032
Search identical group
Phylum/Class[AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment
Species
Start position on genome 1013
End posion on genome 929
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
tataaaatat
tRNA gene sequence
GCGGATATGGTGGAATTGGTAGACACGTAGCCTTGAGGGGGCTATGACTTCGGTCGTGAG
AGTTCAAGTCTCTCTATCCGCACCA
Downstream region at tRNA end position
gattttatta
Secondary structure (Cloverleaf model)
>WENV170014369	Leu	GAG
                   t      ACCA gattttatta
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     A - T          T G
                    T     C T C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G A G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGACTTCGGTCGT
                    T - A
                    A - T
                    G - C
                    C - G
                    C - G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK