Sequence ID | >WENV170014377 |
Genome ID | AYRF01005568 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 110 |
End posion on genome | 35 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
acaatatgaa |
tRNA gene sequence |
GCGGTACTAGCTCAGTGGGTAGAGCACGACCTTGCCAAGGTCGGGGTCACGAGTTCGAGT |
Downstream region at tRNA end position |
aatttcactt |
Secondary structure (Cloverleaf model) | >WENV170014377 Gly GCC a TCCA aatttcactt G - C C - G G - C G - C T - A A - T C - G T G T T G C T C A T G A A | | | | | G G C T C G A C G A G C G | | | | T T G G A G C T A A GGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |