Sequence ID | >WENV170014385 |
Genome ID | AYRF01012716 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 187 |
End posion on genome | 263 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gatttactgt |
tRNA gene sequence |
CGGACATTAGCGCAGCTTGGTAGCGCACATCTCTGGGGGAGATGGGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
cttttcaaag |
Secondary structure (Cloverleaf model) | >WENV170014385 Pro GGG t ACCA cttttcaaag C - G G - C G - C A - T C - G A - T T - A T A T T G T C C A C G A A | | | | | A T C G C G A C A G G C T | | | | T T G G C G C G T A A GGGTC C - G A - T T - A C - G T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |