Sequence ID | >WENV170014395 |
Genome ID | AYRF01021369 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 101 |
End posion on genome | 25 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aaaaactaat |
tRNA gene sequence |
CGGTATGTAGCGCAGCTTGGTAGCGCACTGTCATGGGGTGTCAGGGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
atcctccttt |
Secondary structure (Cloverleaf model) | >WENV170014395 Pro GGG t ACCA atcctccttt C - G G - C G - C T - A A - T T - A G - C T A T T C T C C A C G A A + | | | | A T C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A G - C T T C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |