Sequence ID | >WENV170014399 |
Genome ID | AYRF01022528 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 2 |
End posion on genome | 86 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
GCGGAAGTGGCGGAATTGGTAGACGCGCTAGATTTAGGTTCTAGTATCGTAAGGTGTGAG |
Downstream region at tRNA end position |
ttctttactt |
Secondary structure (Cloverleaf model) | >WENV170014399 Leu TAG t ACCA ttctttactt G - C C - G G - C G - C A - T A - T G - C T G T C T C T C A T A A G | | | | | A T G G C G G A G A G C G | | | T T G A C G C T A G G TATCGTAAGGTGT C - G T - A A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |