Sequence ID | >WENV170014431 |
Genome ID | AYRG01000066 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 2052 |
End posion on genome | 2126 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taggtaataA |
tRNA gene sequence |
GCTCCTATGGCACAGTAGGTAGCGCGCATCCATGGTAAGGATGAGGTCACCGGTTCGAAT |
Downstream region at tRNA end position |
ggaatctcat |
Secondary structure (Cloverleaf model) | >WENV170014431 Thr GGT A TTaa ggaatctcat G - C C - G T - A C - G C - G T - A A - T T A T T G G C C A T G A G | | | | | G A C A C G A C C G G C G | | | T T G G C G C T A G AGGTC C - G A - T T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |