Sequence ID | >WENV170014434 |
Genome ID | AYRG01000076 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 31538 |
End posion on genome | 31461 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
CGGGGCGTAGCGCAGTCTGGTTAGCGCACCTGGTTTGGGACCAGGGGGCCGGAGGTTCGA |
Downstream region at tRNA end position |
tttaattatt |
Secondary structure (Cloverleaf model) | >WENV170014434 Pro TGG t ACCA tttaattatt C - G G - C G - C G - C G - C C - G G - C T A T T C T C C A C T G A A + | | | | G T C G C G G G A G G C G | | | | T T G G C G C T T A A GGGCC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |