Sequence ID | >WENV170014492 |
Genome ID | AYRG01002732 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 223 |
End posion on genome | 148 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gcaatgattc |
tRNA gene sequence |
GCTCATGTAGCTCAGTTGGTAGAGCACACCCTTGGTAAGGGTGAGGTCAGCGGTTCAACT |
Downstream region at tRNA end position |
ttgtgtaaat |
Secondary structure (Cloverleaf model) | >WENV170014492 Thr GGT c TCCA ttgtgtaaat G - C C - G T - A C - G A - T T - A G - C T C T T C G C C A T G A A | | | | | A T C T C G A G C G G C G | | | | T T G G A G C T A A AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |