Sequence ID | >WENV170014530 |
Genome ID | AYRH01001160 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 311 |
End posion on genome | 387 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gttatgaagt |
tRNA gene sequence |
GGAGCGGTAGTTCAGTTGGTTAGAATACCTGCCTGTCACGCAGGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
cttcttttcc |
Secondary structure (Cloverleaf model) | >WENV170014530 Asp GTC t GCCA cttcttttcc G - C G - C A - T G + T C - G G - C G - C T G T T G C C C A T G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |