Sequence ID | >WENV170014537 |
Genome ID | AYRH01001924 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 139 |
End posion on genome | 63 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cctcacggtt |
tRNA gene sequence |
CGGGTAGTAGCGCAGCCTGGTAGCGCACTTCACTGGGGGTGAAGGGGTCGTCGGTTCAAA |
Downstream region at tRNA end position |
atctttccca |
Secondary structure (Cloverleaf model) | >WENV170014537 Pro GGG t ACCA atctttccca C - G G - C G - C G - C T - A A - T G - C T A T C G G C C A C G A A | + | | | A C C G C G G T C G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A C - G A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |