Sequence ID | >WENV170014550 |
Genome ID | AYRH01005545 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 267 |
End posion on genome | 342 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cattcggtaa |
tRNA gene sequence |
GCCGCTGTAGCTCAGATGGTAGAGCACGTCATTCGTAATGATGGGGTCGAAGGTTCGAGT |
Downstream region at tRNA end position |
cacacactct |
Secondary structure (Cloverleaf model) | >WENV170014550 Thr CGT a ACCA cacacactct G - C C - G C - G G - C C - G T - A G - C T G T T T T C C A A G A A + | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |