Sequence ID | >WENV170014579 |
Genome ID | AYRH01017535 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 237 |
End posion on genome | 312 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
catattaagc |
tRNA gene sequence |
TGTCCCATGGTGTAATTGGCAACACGTCTGTTTTTGGTACAGAAGAGTCTAGGTTCGAGA |
Downstream region at tRNA end position |
aannnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170014579 Gln TTG c ACAA aannnnnnnn T - A G - C T - A C - G C - G C - G A - T A G T G A T C C A T A A G | | | | | G T T G T G C T A G G C G | | | | T T G A C A C C A G AGAGT T - A C - G T - A G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |