Sequence ID | >WENV170014580 |
Genome ID | AYRH01017723 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 66 |
End posion on genome | 141 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aatgtagcat |
tRNA gene sequence |
GCGACACTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCATCGGTTCGAAC |
Downstream region at tRNA end position |
aatttcttta |
Secondary structure (Cloverleaf model) | >WENV170014580 Gly GCC t TCCA aatttcttta G - C C - G G - C A - T C - G A - T C - G C A T T A G C C A T G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |