Sequence ID | >WENV170014583 |
Genome ID | AYRH01019191 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccgacagagt |
tRNA gene sequence |
GGCCCGTTCGTCTATCGGTTAGGACGCCAGGTTTTCAACCTGGAAAGACGAGTTCGATTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170014583 Glu TTC t GCCA nnnnnnnnnn G + T G - C C - G C - G C - G G - C T - A T T T T G C T C A C T A C | | | | | G G T C T G A C G A G C G + | | | T T T G G A C T A G AAAG C - G C - G A - T G - C G - C T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |