Sequence ID | >WENV170014591 |
Genome ID | AYRH01024367 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 140 |
End posion on genome | 64 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gtgaaaattt |
tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCGCTCGCCTGATAAGCGGGAGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
aattttcctt |
Secondary structure (Cloverleaf model) | >WENV170014591 Ile GAT t ACCA aattttcctt G - C G - C G - C T - A C - G T - A G - C T G T T C A C C A C G A A + | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G T + G C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |