Sequence ID | >WENV170014605 |
Genome ID | AYSL01000008 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 2976 |
End posion on genome | 3061 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaaagttttc |
tRNA gene sequence |
GCGGAAGTGGTGGAATTGGTAGACACGCCATCTTGAGGGGGTGGTGAGCATAGCTCGTGC |
Downstream region at tRNA end position |
aataaatgta |
Secondary structure (Cloverleaf model) | >WENV170014605 Leu GAG c ACCA aataaatgta G - C C - G G - C G - C A - T A - T G + T T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGAGCATAGCTCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |