Sequence ID | >WENV170014655 |
Genome ID | AYSL01003028 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 125 |
End posion on genome | 36 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgaatcgtta |
tRNA gene sequence |
GGTGAAGTGGGTGAGTGGCTGAAACCAGTTCCCTGCTAAGGAACCATACGTGTAAGCGTA |
Downstream region at tRNA end position |
tttattcagt |
Secondary structure (Cloverleaf model) | >WENV170014655 Ser GCT a GCCA tttattcagt G - C G - C T - A G - C A - T A - T G - C T A T C T C C C A T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CATACGTGTAAGCGTATC G - C T - A T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |