Sequence ID | >WENV170014663 |
Genome ID | AYSL01003440 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 1189 |
End posion on genome | 1264 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gagagaacaa |
tRNA gene sequence |
GCCGACTTAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCGCCAGTTCGATC |
Downstream region at tRNA end position |
tctcttttaa |
Secondary structure (Cloverleaf model) | >WENV170014663 Thr TGT a ACCA tctcttttaa G - C C - G C - G G - C A - T C - G T - A C T T C G G C C A T G A A | | | | G T C T C G G C C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |