Sequence ID | >WENV170014665 |
Genome ID | AYSL01003440 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 1501 |
End posion on genome | 1574 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tagagtaaat |
tRNA gene sequence |
GCGGGTGTGGTATAATGGTAACACCTTAGCCTTCCAAGCTAATGACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
tatatacacc |
Secondary structure (Cloverleaf model) | >WENV170014665 Gly TCC t TCCA tatatacacc G - C C - G G - C G - C G - C T - A G - C T T T C G C C C A A A G | | | | | G T T A T G G C G G G C G | | | T T G A C A C T A C TGAC T - A T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |