Sequence ID | >WENV170014666 |
Genome ID | AYSL01003440 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 1678 |
End posion on genome | 1752 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tacactatac |
tRNA gene sequence |
GCTCATATAGCTCAGCGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCTCGAGTTCAATTC |
Downstream region at tRNA end position |
tttattatgt |
Secondary structure (Cloverleaf model) | >WENV170014666 Thr GGT c TCCA tttattatgt G - C C - G T - A C - G A - T T - A A - T T T T A G C T C A G A A | | | | | A C C T C G T C G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |