Sequence ID | >WENV170014683 |
Genome ID | AYSL01004992 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 4647 |
End posion on genome | 4737 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttcaaaaaac |
tRNA gene sequence |
GGTGAAGTGGGTGAGTGGCTGAAACCGCACGCCTGGAAAGTGTGTATACGTTAATCGCGT |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170014683 Ser GGA c GCCA annnnnnnnn G - C G - C T - A G - C A - T A - T G - C T A T C T C C C A T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A G TATACGTTAATCGCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |