Sequence ID | >WENV170014741 |
Genome ID | AYSL01008401 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 163 |
End posion on genome | 77 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tatacacaat |
tRNA gene sequence |
GCCAGTGTGATGGAATTGGTAGACATGGCGGATTCAAAATCCGCTGCTAGCGATAGCGTG |
Downstream region at tRNA end position |
tctcttcttt |
Secondary structure (Cloverleaf model) | >WENV170014741 Leu CAA t ACCA tctcttcttt G + T C - G C - G A - T G - C T - A G - C T G T C C G C C A T A A G | | | | | A T G G T A G G C G G C G | | | T T G A C A T T A G G TGCTAGCGATAGCGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |