Sequence ID | >WENV170014753 |
Genome ID | AYSL01009061 |
Phylum/Class | [AYSL] marine sediment metagenome; marine sediment samples in the proximity of a phosphate-oil terminal |
Species | |
Start position on genome | 2555 |
End posion on genome | 2469 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gcaacccgat |
tRNA gene sequence |
GCCCGGGTGGTGAAATTGGTAGACACAAGGGATTTAAAATCCCTCGCTGGTAACAGCGTG |
Downstream region at tRNA end position |
ttttctttcc |
Secondary structure (Cloverleaf model) | >WENV170014753 Leu TAA t ACCA ttttctttcc G - C C - G C - G C - G G - C G - C G - C T G T C G G C C A T A A G | | | | | A T A G T G G C C G G C G | | | T T G A C A C T A G A CGCTGGTAACAGCGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |