| Sequence ID | >WENV170014826 |
| Genome ID | AZIC01000011 |
| Phylum/Class | [AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy) |
| Species | |
|
Start position on genome
|
144
|
|
End posion on genome
|
220
|
|
Amino Acid
|
Ile
|
|
Anticodon
|
GAT
|
|
Upstream region at tRNA start position
|
ggtatacagt
|
|
tRNA gene sequence
|
GGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGCCGTTCAAA TCGGCCCAGACCCACCA
|
|
Downstream region at tRNA end position
|
aatcctgtat
|
| Secondary structure (Cloverleaf model) | >WENV170014826 Ile GAT
t ACCA aatcctgtat
G - C
G - C
G - C
T - A
C - G
T - A
G - C T A
T C C G G C A
T G A A | | | | | A
T C T C G G G C C G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |