The detailed information of tRNA gene sequence


Sequence ID>WENV170014851
Genome IDAZIC01000965
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 172
End posion on genome 83
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ggcttgaaac
tRNA gene sequence
GGAGAGCTGGCCGAGTGGCTGAAGGCGCACCCCTGCTAAGGGTGTATAGGTTTACCCCTA
TCGAGGGTTCGAATCCCTCGCTCTCCGCCA
Downstream region at tRNA end position
aaaaattaat
Secondary structure (Cloverleaf model)
>WENV170014851	Ser	GCT
                   c      GCCA aaaaattaat
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     C - G          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G C C G       G A G G G     C
    G         | | |                 T T
    C       A G G C
      T G A        G     TATAGGTTTACCCCTATC
                    C - G
                    A - T
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK