The detailed information of tRNA gene sequence


Sequence ID>WENV170014954
Genome IDAZIC01005184
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 16803
End posion on genome 16887
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
cgcgccttat
tRNA gene sequence
GCGAGCGTGGCGAAATTGGTATACGCGCCAGATTTAGGTTCTGGTGTCGCAAGACGTGAG
AGTTCGAGTCTCTCCGCTCGCACCA
Downstream region at tRNA end position
tctttttata
Secondary structure (Cloverleaf model)
>WENV170014954	Leu	TAG
                   t      ACCA tctttttata
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C
                     C - G
                     G - C          T G
                    T     C T C T C     A
      T A A        G      | | | | |     G
    T       A G C G       G A G A G     C
    G         | | |                 T T
    G       A C G C
      T A T        G     TGTCGCAAGACGT
                    C - G
                    C - G
                    A - T
                    G - C
                    A - T
                  T       T
                  T       G
                    T A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK