The detailed information of tRNA gene sequence


Sequence ID>WENV170014961
Genome IDAZIC01008399
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 274
End posion on genome 201
Amino Acid Gln
Anticodon CTG
Upstream region at tRNA start position
ctgcaccgaa
tRNA gene sequence
TGCCCGGTCGTCCAACGGCAGGACAGCTGACTCTGGCTCAGTCGATGAGGGTTCGAATCC
TTCCCGGGCAACCA
Downstream region at tRNA end position
gaattccgat
Secondary structure (Cloverleaf model)
>WENV170014961	Gln	CTG
                   a      ACCA gaattccgat
                     T - A
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C          T A
                    T     C T T C C     A
        A A        C      | | + | |     G
      C     C C T G       G A G G G     C
      G     | | | |                 T T
      G     G G A C
        C A        A     CGAT
                    G + T
                    C - G
                    T - A
                    G - C
                    A - T
                  C       C
                  T       G
                    C T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK