The detailed information of tRNA gene sequence


Sequence ID>WENV170014963
Genome IDAZIC01008638
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 66
End posion on genome 141
Amino Acid Thr
Anticodon TGT
Upstream region at tRNA start position
cgtacttcgg
tRNA gene sequence
GCTGGCGTAGCTCAACTGGTAGAGCACCTCACTTGTAATGAGGTGGTTGGGGGTTCAAGT
CCTCTCGCCAGCTCCA
Downstream region at tRNA end position
gcctgaggat
Secondary structure (Cloverleaf model)
>WENV170014963	Thr	TGT
                   g      TCCA gcctgaggat
                     G - C
                     C - G
                     T - A
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     T C T C C     A
      C A A        A      + | + | |     A
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     TGGTT
                    C - G
                    C - G
                    T - A
                    C - G
                    A - T
                  C       A
                  T       A
                    T G T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK