The detailed information of tRNA gene sequence


Sequence ID>WENV170014970
Genome IDAZIC01010143
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 157
End posion on genome 229
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
tttaacaaaa
tRNA gene sequence
GCTTGTGAAGCTCAATTGGTCGAGCGGAACGTTGAAGTTGTTTAGGCTGTAGGTTCAAAT
CCTATCACGAGCAtac
Downstream region at tRNA end position
catatatgtt
Secondary structure (Cloverleaf model)
>WENV170014970	Phe	GAA
                   a      Atac catatatgtt
                     G - C
                     C - G
                     T - A
                     T + G
                     G - C
                     T - A
                     G - C          T A
                    A     T A T C C     A
      T A A        A      + | | | |     A
    T       C T C G       G T A G G     C
    G       | | | |                 T T
    G       G A G C
      T C          G     AGGCT
                    G + T
                    A - T
                    A - T
                    C - G
                    G + T
                  T       T
                  T       G
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK