The detailed information of tRNA gene sequence


Sequence ID>WENV170015009
Genome IDAZIC01016899
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 214
End posion on genome 125
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
acaagacctt
tRNA gene sequence
GGAGAGATGACTGAGTGGCTGAAAGTGGCACCCTGCTAAGGTGTTGTACCTTTACGGGTA
CCGAGGGTTCGAATCCCTCTCTCTCCGCCA
Downstream region at tRNA end position
agagaacagc
Secondary structure (Cloverleaf model)
>WENV170015009	Ser	GCT
                   t      GCCA agagaacagc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C A       G A G G G     C
    G         | | |                 T T
    C       A A G T
      T G A        G     TGTACCTTTACGGGTACC
                    G + T
                    C - G
                    A - T
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK