The detailed information of tRNA gene sequence


Sequence ID>WENV170015012
Genome IDAZIC01017213
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 890
End posion on genome 977
Amino Acid Leu
Anticodon CAG
Upstream region at tRNA start position
catccattat
tRNA gene sequence
GCGGGGGTTGCCCAGCCTGGCCAAAGGCGCTAGGTTCAGAGCCTAGTCTCGTAGGAGTTC
AAGGGTTCGAATCCCTTCTCCCGCACCA
Downstream region at tRNA end position
tgagcttttt
Secondary structure (Cloverleaf model)
>WENV170015012	Leu	CAG
                   t      ACCA tgagcttttt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G + T
                     G - C          T A
                    T     T T C C C     A
    C C G A        T      | | | | |     G
  T         C C C G       A A G G G     C
  G           | | |                 T T
  G         A G G C
    C C A A        G     TCTCGTAGGAGTTC
                    C - G
                    T - A
                    A - T
                    G - C
                    G - C
                  T       G
                  T       A
                    C A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK