The detailed information of tRNA gene sequence


Sequence ID>WENV170015017
Genome IDAZIC01017669
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 266
End posion on genome 190
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tgaaattatt
tRNA gene sequence
GGGGGCGTAGCTCAGTTGGTTAGAGCGTCTGCTTGTCACGCAGAAGGTCGCGCGTTCGAG
TCGCGTCGTCCCCGCCA
Downstream region at tRNA end position
agaaaaaaac
Secondary structure (Cloverleaf model)
>WENV170015017	Asp	GTC
                   t      GCCA agaaaaaaac
                     G - C
                     G - C
                     G - C
                     G - C
                     G + T
                     C - G
                     G - C          T G
                    T     T G C G C     A
      T G A        A      + | | | |     G
    T       C T C G       G C G C G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    T - A
                    C - G
                    T - A
                    G - C
                    C - G
                  T       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK