The detailed information of tRNA gene sequence


Sequence ID>WENV170015036
Genome IDAZIC01018793
Search identical group
Phylum/Class[AZIC] marine sediment metagenome; sample MGS-MES from oil contaminated site at the harbour of Messina (Sicily, Italy)
Species
Start position on genome 920
End posion on genome 1007
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
tctaagaaaa
tRNA gene sequence
GGAAGGGTGACTGAGTGGCTGAAAGTGCTGCTCTCGAAAAGCAGTGAGTCTAACGGCTCC
GCGGGTTCGAATCCCGCTCCTTCCGCCA
Downstream region at tRNA end position
gtaaaagata
Secondary structure (Cloverleaf model)
>WENV170015036	Ser	CGA
                   a      GCCA gtaaaagata
                     G - C
                     G - C
                     A - T
                     A - T
                     G - C
                     G - C
                     G + T          T A
                    T     C G C C C     A
      T G A        G      | | | | |     G
    G       G T C A       G C G G G     C
    G         | | |                 T T
    C       A A G T
      T G A        G     TGAGTCTAACGGCTCC
                    C - G
                    T - A
                    G - C
                    C - G
                    T - A
                  C       A
                  T       A
                    C G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK